Bacterial

genotyping

Nucleic acids (DNA & RNA) ...

... could be cast to strings

>gi|176120924|ref|NC_001417.2| Enterobacterio phage MS2, complete genome
GGGTGGGACCCCTTTCGGGGTCCTGCTCAACTTCCTGTCGAGCTAATGCCATTTTTAATGTCTTTAGCGA
GACGCTACCATGGCTATCGCTGTAGGTAGCCGGAATTCCATTCCTAGGAGGTTTGACCTGTGCGAGC...

Tandem Repeat (TR)

Consecutive sequences of 1 to more than 200 nucleotides, perfectly identical or not.

ATTGCCAG ATTGCCAG ATCGCCAG ATTGGCAG ATTGC...

• TR are found in all genomes.
• Intragenic & intergenic regions.

Variable Number of Tandem Repeat (VNTR)

A polymorphic TR is called VNTR

[...] variations in the repeat number contribute to adaption to environmental changes, through protein function [...] or through regulation of gene expression

Multiple Loci VNTR Analysis (MLVA)

• Genotyping method
• Intra-species comparison of strains
• Analysis of several (multiple) VNTRs dispersed on the genome
• Deduce the strain code corresponding to the number of repeats at each VNTR

e.g. for VNTRs A - B - C:

Strain_01 : 7 - 10 - 4 // Strain_02 : 8 - 4 - 7

Why do we need bacterial genotyping?

• To compare large numbers of strains isolated from clinical and environmental sources
• To perform outbreak investigations
• To study bacterial population structure and emergence of clones
• To invest the origin of a biological sample (biodefense, forensics)

The people

G. Vergnaud, PhD

• Scientific head of MicroGeno
• Searching for a lead developer
• MLVABank code refactoring

ComSource

{ TailorDev }

• Web & print agency
• Toulouse & Clermont-Ferrand, France
• Julien Maupetit, PhD, Co-Founder (CTO)
• Strong background in bio-informatics

The past

MLVABank

• From 2007 to 2013
• Originally developed & maintained by Paris Sud
• PHP & JavaScript, no framework

MLVABank features

• User-friendly
• Cooperative databases
• Contributors keep control of their data
• MLVA data, but not only...

The present

• MicroGeno is the new MLVABank
• Development started in 2012
• Completely rewrote from scratch
• Python - Django web framework
• Twitter Bootstrap

MicroGeno core features

• Logical data storage (relational database schema)
• in situ clusters analysis (dendrogram, MST)
• Not dedicated to a particular species
• Supports MLVA, MLST, SNP, SPOLIGO and CRISPR data
• Cloud-ready (SaaS & PaaS)

Demo party!

The future

Ongoing directions (1)

• Open Source
• Docs, docs, docs (developers and end-users)
• Tests, tests, tests (TDD)
• Move front-end to a JS framework such as AngularJS

Ongoing directions (2)

• REST API
• Local analysis tools
• Synchronize (selected) data to the/your cloud

Ongoing directions (3)

MicroGeno Chip